BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg474898 Length=498 Score E Sequences producing significant alignments: (Bits) Value AT1G64490.1 | Symbols: | DEK, chromatin associated protein | c... 63.9 1e-09 > AT1G64490.1 | Symbols: | DEK, chromatin associated protein | chr1:23952133-23952713 FORWARD LENGTH=581 Length=581 Score = 63.9 bits (34), Expect = 1e-09 Identities = 36/37 (97%), Gaps = 0/37 (0%) Strand=Plus/Plus Query 407 ATGTCATTAGTTGAAATTAGTGTTTTAGCCATTGATA 443 ||||| ||||||||||||||||||||||||||||||| Sbjct 476 ATGTCTTTAGTTGAAATTAGTGTTTTAGCCATTGATA 512 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 23760751531 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5