BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg893756 Length=1044 Score E Sequences producing significant alignments: (Bits) Value AT5G49140.1 | Symbols: | Disease resistance protein (TIR-NBS-L... 76.8 4e-13 > AT5G49140.1 | Symbols: | Disease resistance protein (TIR-NBS-LRR class) family | chr5:19919085-19923415 REVERSE LENGTH=2943 Length=2943 Score = 76.8 bits (41), Expect = 4e-13 Identities = 53/59 (90%), Gaps = 0/59 (0%) Strand=Plus/Plus Query 193 AACTACGCTTCTTCAAGCTGGTGTTTGGATGAGTTAGTGGAAATCATGAAGTGCAAGGA 251 ||||| ||||||||||||||||||||||||||||| || ||||| | ||||||||||| Sbjct 232 AACTATGCTTCTTCAAGCTGGTGTTTGGATGAGTTGGTTGAAATTTTAAAGTGCAAGGA 290 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 51188595793 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5