BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg904826 Length=228 Score E Sequences producing significant alignments: (Bits) Value AT2G16140.1 | Symbols: | transposable element gene | chr2:7005... 100 5e-21 > AT2G16140.1 | Symbols: | transposable element gene | chr2:7005823-7008272 FORWARD LENGTH=2450 Length=2450 Score = 100 bits (54), Expect = 5e-21 Identities = 68/75 (91%), Gaps = 0/75 (0%) Strand=Plus/Plus Query 109 TTTGTGAACCTCTTAACTAGTCAACAAGAGGTTCACAATCTAGAAGCCAATCCGTATGAT 168 ||||||||||||||||||||||||||||||||||||| | | ||| ||||||||| |||| Sbjct 856 TTTGTGAACCTCTTAACTAGTCAACAAGAGGTTCACACTTTGGAAACCAATCCGTGTGAT 915 Query 169 GATGTCCCTGTCTTT 183 ||||| ||| ||||| Sbjct 916 GATGTTCCTATCTTT 930 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10254620796 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5