BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg909552 Length=2262 Score E Sequences producing significant alignments: (Bits) Value AT2G21820.1 | Symbols: | unknown protein; Has 45 Blast hits to... 65.8 2e-09 > AT2G21820.1 | Symbols: | unknown protein; Has 45 Blast hits to 45 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:9302885-9303247 REVERSE LENGTH=363 Length=363 Score = 65.8 bits (35), Expect = 2e-09 Identities = 44/48 (92%), Gaps = 1/48 (2%) Strand=Plus/Plus Query 2066 ATCAACAATGTCGGGAGCACAAGGAGCAGAGCCGATGGGGTCAA-AAC 2112 |||||| ||||||||||||||||||||||||||||||| |||| ||| Sbjct 22 ATCAACGATGTCGGGAGCACAAGGAGCAGAGCCGATGGATTCAAGAAC 69 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 112248418620 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5