BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg911526 Length=741 Score E Sequences producing significant alignments: (Bits) Value AT5G28823.1 | Symbols: | FUNCTIONS IN: molecular_function unkn... 134 2e-30 > AT5G28823.1 | Symbols: | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: Zinc knuckle (CCHC-type) family protein (TAIR:AT2G07760.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:10837849-10839826 REVERSE LENGTH=1707 Length=1707 Score = 134 bits (72), Expect = 2e-30 Identities = 119/141 (84%), Gaps = 6/141 (4%) Strand=Plus/Plus Query 606 TTCTTCAGA-CACGAATGTGATGGCTACTCCCGCAAAGGTTTTTTCAATTATCACTACCT 664 ||||||| | || ||| ||||||||||||||||||||||| | | ||| || |||||||| Sbjct 1344 TTCTTCA-ACCATGAAAGTGATGGCTACTCCCGCAAAGGTCTCTACAAATAACACTACCT 1402 Query 665 CGGCTTCAGTTGTCCAATCTAGTGCTAAT--TT-TTTC-GCAAAGCTTCTAGTTCAAATA 720 | || ||| ||| |||||||| ||||| || |||| ||||||||||||||||||||| Sbjct 1403 CTACTGCAGGGGTCAAATCTAGTACTAATACTTCTTTCCGCAAAGCTTCTAGTTCAAATA 1462 Query 721 AATTTGCAGTGCTCGATTTAG 741 ||||||| ||||| ||||||| Sbjct 1463 AATTTGCGGTGCTGGATTTAG 1483 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 35967649252 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5