BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg925746 Length=1549 Score E Sequences producing significant alignments: (Bits) Value AT5G01080.1 | Symbols: | Beta-galactosidase related protein | ... 52.8 1e-05 AT1G30784.1 | Symbols: | Pseudogene of AT5G01080; beta-galacto... 52.8 1e-05 > AT5G01080.1 | Symbols: | Beta-galactosidase related protein | chr5:28532-29086 REVERSE LENGTH=555 Length=555 Score = 52.8 bits (28), Expect = 1e-05 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand=Plus/Plus Query 904 TTAAAAGCTTGAAGAAGAACGGCATTAT 931 |||||||||||||||||||||||||||| Sbjct 221 TTAAAAGCTTGAAGAAGAACGGCATTAT 248 > AT1G30784.1 | Symbols: | Pseudogene of AT5G01080; beta-galactosidase | chr1:10929536-10930090 REVERSE LENGTH=555 Length=555 Score = 52.8 bits (28), Expect = 1e-05 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand=Plus/Plus Query 904 TTAAAAGCTTGAAGAAGAACGGCATTAT 931 |||||||||||||||||||||||||||| Sbjct 221 TTAAAAGCTTGAAGAAGAACGGCATTAT 248 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 76455430035 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5