BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg928829 Length=317 Score E Sequences producing significant alignments: (Bits) Value AT3G11160.1 | Symbols: | unknown protein; Has 6 Blast hits to ... 73.1 1e-12 > AT3G11160.1 | Symbols: | unknown protein; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | chr3:3496067-3497163 REVERSE LENGTH=714 Length=714 Score = 73.1 bits (39), Expect = 1e-12 Identities = 43/45 (96%), Gaps = 0/45 (0%) Strand=Plus/Plus Query 16 CGATCATGGCACCGAACAACAATCTGAGATCCGTAATCGCGCAGT 60 |||||||| ||||||||||||||||||||||||||||||| |||| Sbjct 102 CGATCATGCCACCGAACAACAATCTGAGATCCGTAATCGCTCAGT 146 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14728450457 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5