BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg937102 Length=246 Score E Sequences producing significant alignments: (Bits) Value AT3G54470.1 | Symbols: | uridine 5'-monophosphate synthase / U... 97.1 6e-20 > AT3G54470.1 | Symbols: | uridine 5'-monophosphate synthase / UMP synthase (PYRE-F) (UMPS) | chr3:20168095-20170303 REVERSE LENGTH=1679 Length=1679 Score = 97.1 bits (52), Expect = 6e-20 Identities = 54/55 (98%), Gaps = 0/55 (0%) Strand=Plus/Plus Query 17 TCAAATGGTGAAAGGTGGTGATGCACTTGGTCAACAGTATAACACTCCACACTCT 71 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 1303 TCAAATGGTGAAAGGTGGTGATGCACTTGGTCAGCAGTATAACACTCCACACTCT 1357 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11159440278 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5