BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg949798 Length=478 Score E Sequences producing significant alignments: (Bits) Value AT1G17360.1 | Symbols: | BEST Arabidopsis thaliana protein mat... 104 8e-22 > AT1G17360.1 | Symbols: | BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 9949 Blast hits to 7480 proteins in 576 species: Archae - 12; Bacteria - 1007; Metazoa - 3636; Fungi - 982; Plants - 444; Viruses - 50; Other Eukaryotes - 3818 (source: NCBI BLink). | chr1:5946764-5951473 FORWARD LENGTH=3530 Length=3530 Score = 104 bits (56), Expect = 8e-22 Identities = 63/66 (95%), Gaps = 1/66 (2%) Strand=Plus/Plus Query 245 AGTTGGAAGCAGCTCGGACATTATATTCTCAAGACGATGGAGGCGTAGCAGATGCAACAA 304 |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 584 AGTTGGAAGCAGCTCGGACATTATATTCTCAAGATGATGGAGGCGTAGCAGATGCAACAC 643 Query 305 ATGAAG 310 | |||| Sbjct 644 A-GAAG 648 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 22756068591 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5