BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg950326 Length=513 Score E Sequences producing significant alignments: (Bits) Value AT5G56544.1 | Symbols: | pseudogene of arginyl-tRNA synthetase... 104 8e-22 > AT5G56544.1 | Symbols: | pseudogene of arginyl-tRNA synthetase | chr5:22894502-22895791 FORWARD LENGTH=605 Length=605 Score = 104 bits (56), Expect = 8e-22 Identities = 98/116 (84%), Gaps = 12/116 (10%) Strand=Plus/Plus Query 243 GGAAAGCTAGTGTTGAATCATGCGGATGAACGAGCACTAGGACTTCACT-C----GCTAC 297 |||| ||||||||||||||||||||||||||||| |||||||||||||| | ||||| Sbjct 256 GGAATGCTAGTGTTGAATCATGCGGATGAACGAGTACTAGGACTTCACTTCACTTGCTAC 315 Query 298 GATTTTC-T-----G-AGACTGTTGAGGAAGTATTTACCAATTTGTTACCAAGCGT 346 ||||| | | | ||||| ||||| |||||| ||||||||||||||||||||| Sbjct 316 GATTTGCGTTTTTTGCAGACTATTGAGAAAGTATGTACCAATTTGTTACCAAGCGT 371 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 24514263736 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5