BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg952321 Length=218 Score E Sequences producing significant alignments: (Bits) Value AT5G40670.1 | Symbols: | PQ-loop repeat family protein / trans... 100 4e-21 > AT5G40670.1 | Symbols: | PQ-loop repeat family protein / transmembrane family protein | chr5:16285711-16287793 FORWARD LENGTH=1272 Length=1272 Score = 100 bits (54), Expect = 4e-21 Identities = 60/63 (95%), Gaps = 0/63 (0%) Strand=Plus/Plus Query 48 AGCTATATGTTTCTTCATAGCATTACCTACACACTCTTGGCTATGGCTCATCTCGATCTT 107 |||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||| Sbjct 662 AGCTATCTGTTTCTTCATAGCATTACCTACACACTCTTGGCTATGGCTCATTTCAATCTT 721 Query 108 CAA 110 ||| Sbjct 722 CAA 724 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9751943306 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5