BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg315925 Length=654 Score E Sequences producing significant alignments: (Bits) Value AT1G68940.3 | Symbols: | Armadillo/beta-catenin-like repeat fa... 119 4e-26 > AT1G68940.3 | Symbols: | Armadillo/beta-catenin-like repeat family protein | chr1:25921453-25925845 REVERSE LENGTH=3525 Length=3525 Score = 119 bits (64), Expect = 4e-26 Identities = 90/103 (87%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 546 TTGGTCTGCCGAGGTTTCCTTGGAGAGACGCGAGGGATGCAAAATTCGGGGGAAGATTGA 605 ||||| ||| ||| ||||| |||||||| |||| ||| || | ||| |||||||||||| Sbjct 3381 TTGGTGTGCTGAGATTTCCGTGGAGAGAGGCGATGGAGGCGAGATTTGGGGGAAGATTGT 3440 Query 606 GTGGTCCAGTGCTATCTACAAACTTGATCCTCTCTCACACTCA 648 ||||||| ||||| ||||||||||||||||||||||||||||| Sbjct 3441 GTGGTCCGGTGCTGTCTACAAACTTGATCCTCTCTCACACTCA 3483 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 31597278463 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5