BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg322539 Length=234 Score E Sequences producing significant alignments: (Bits) Value AT5G49465.1 | Symbols: | transposable element gene | chr5:2005... 100 5e-21 > AT5G49465.1 | Symbols: | transposable element gene | chr5:20059842-20062191 REVERSE LENGTH=2350 Length=2350 Score = 100 bits (54), Expect = 5e-21 Identities = 64/69 (93%), Gaps = 0/69 (0%) Strand=Plus/Minus Query 25 GCCTCTTACAAGGCGTGGTGGTTGCTTTCGCTTCTGTCCGGTTCGATCTCCTGCCGTTTA 84 |||| |||| ||| ||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 272 GCCTATTACCAGGTATGGTGGTTGCTTTCGCTTCTGTCCGGTTCGATCTCCTACCGTTTA 213 Query 85 TCTTCTTCG 93 ||||||||| Sbjct 212 TCTTCTTCG 204 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10556227290 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5