BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg322696 Length=429 Score E Sequences producing significant alignments: (Bits) Value AT3G11410.1 | Symbols: ATPP2CA, AHG3, PP2CA | protein phosphata... 111 4e-24 > AT3G11410.1 | Symbols: ATPP2CA, AHG3, PP2CA | protein phosphatase 2CA | chr3:3583883-3585790 REVERSE LENGTH=1639 Length=1639 Score = 111 bits (60), Expect = 4e-24 Identities = 73/79 (92%), Gaps = 2/79 (3%) Strand=Plus/Plus Query 109 ACAAGCAGGTGGGCGGGTTAT-TATTGGGATGTAGCTAAGGTTCTTGGAGTTCTTGCCAT 167 |||||| |||||||| ||||| |||||||||| ||||| ||||||||||||||||||||| Sbjct 954 ACAAGCTGGTGGGCGAGTTATATATTGGGATGGAGCTAGGGTTCTTGGAGTTCTTGCCAT 1013 Query 168 GTCTAGAGCAATTG-TGAT 185 |||||||||||||| |||| Sbjct 1014 GTCTAGAGCAATTGGTGAT 1032 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 20358438345 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5