BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg326056 Length=405 Score E Sequences producing significant alignments: (Bits) Value AT5G16090.1 | Symbols: | INVOLVED IN: nucleotide-excision repa... 172 2e-42 > AT5G16090.1 | Symbols: | INVOLVED IN: nucleotide-excision repair; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin (InterPro:IPR000626), Ubiquitin supergroup (InterPro:IPR019955), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: Rad23 UV excision repair protein family (TAIR:AT3G02540.1); Has 1311 Blast hits to 954 proteins in 240 species: Archae - 0; Bacteria - 0; Metazoa - 634; Fungi - 179; Plants - 321; Viruses - 27; Other Eukaryotes - 150 (source: NCBI BLink). | chr5:5255797-5257230 REVERSE LENGTH=516 Length=516 Score = 172 bits (93), Expect = 2e-42 Identities = 154/180 (86%), Gaps = 17/180 (9%) Strand=Plus/Plus Query 1 ATGAAGATAATTGTAAAAACTTTGAAGGGGACTCGCTTCGAGATCGAAGTTAAACCCAAC 60 |||||||| ||||| ||||| |||||||||| |||||||||||||||||| ||||||||| Sbjct 1 ATGAAGATCATTGTCAAAACATTGAAGGGGATTCGCTTCGAGATCGAAGTAAAACCCAAC 60 Query 61 GA-----TT-C---------GAAGAACATAGAGACTGTTCTGGGAGCTAGTGAATATCCT 105 || || | |||||||||||||||||| |||||||||||||||||||| Sbjct 61 GATTCGGTTGCTGAAGTGAAGAAGAACATAGAGACTGTGATGGGAGCTAGTGAATATCCT 120 Query 106 GCTGCACAACAAATTCTTATTCATAAA-GGGAAAAAGCTTAGAGATGAAGCAACAATGGA 164 |||||||||||||| |||||||||||| ||||||| ||||||||||||| |||||||||| Sbjct 121 GCTGCACAACAAATACTTATTCATAAAAGGGAAAA-GCTTAGAGATGAAACAACAATGGA 179 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 19152012369 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5