BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg328776 Length=801 Score E Sequences producing significant alignments: (Bits) Value AT3G43580.1 | Symbols: | Beta-galactosidase related protein | ... 60.2 3e-08 > AT3G43580.1 | Symbols: | Beta-galactosidase related protein | chr3:15502143-15503606 FORWARD LENGTH=1464 Length=1464 Score = 60.2 bits (32), Expect = 3e-08 Identities = 32/32 (100%), Gaps = 0/32 (0%) Strand=Plus/Plus Query 12 TCTAAGGAGCGGTGATTACCGAAGCTTCTTCA 43 |||||||||||||||||||||||||||||||| Sbjct 924 TCTAAGGAGCGGTGATTACCGAAGCTTCTTCA 955 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 38981698072 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5