BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg333502 Length=351 Score E Sequences producing significant alignments: (Bits) Value AT2G42388.1 | Symbols: | other RNA | chr2:17650225-17651083 FO... 89.8 2e-17 > AT2G42388.1 | Symbols: | other RNA | chr2:17650225-17651083 FORWARD LENGTH=631 Length=631 Score = 89.8 bits (48), Expect = 2e-17 Identities = 63/70 (90%), Gaps = 1/70 (1%) Strand=Plus/Plus Query 199 ACAACAGACGTTGACATCAGGCTACCATTGCTAGTTCAAGTTTCCAGAGAGAAGCGGCCT 258 |||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct 109 ACAACATACGTTGACATCAGGCTACCATTGCTAGTTCTTGTTTCGAGAGAGAAGCGGCCT 168 Query 259 GGTTAC-ATT 267 |||| ||| Sbjct 169 ATTTACGATT 178 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 16437553923 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5