BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg334861 Length=1182 Score E Sequences producing significant alignments: (Bits) Value AT5G47260.1 | Symbols: | ATP binding;GTP binding;nucleotide bi... 58.4 2e-07 > AT5G47260.1 | Symbols: | ATP binding;GTP binding;nucleotide binding;nucleoside-triphosphatases | chr5:19189411-19192516 FORWARD LENGTH=2847 Length=2847 Score = 58.4 bits (31), Expect = 2e-07 Identities = 31/31 (100%), Gaps = 0/31 (0%) Strand=Plus/Plus Query 416 TGGTTCGTGAAATGGCCTTGTGGATAGCATC 446 ||||||||||||||||||||||||||||||| Sbjct 1397 TGGTTCGTGAAATGGCCTTGTGGATAGCATC 1427 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 58031830020 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5