BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg337636 Length=489 Score E Sequences producing significant alignments: (Bits) Value AT4G17330.1 | Symbols: ATG2484-1, G2484-1 | G2484-1 protein | c... 52.8 3e-06 > AT4G17330.1 | Symbols: ATG2484-1, G2484-1 | G2484-1 protein | chr4:9688888-9697578 REVERSE LENGTH=6499 Length=6499 Score = 52.8 bits (28), Expect = 3e-06 Identities = 28/28 (100%), Gaps = 0/28 (0%) Strand=Plus/Plus Query 34 GATGGCCAGGAAGAGGATAATACTGCTG 61 |||||||||||||||||||||||||||| Sbjct 2190 GATGGCCAGGAAGAGGATAATACTGCTG 2217 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 23308644208 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5