BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg342694 Length=564 Score E Sequences producing significant alignments: (Bits) Value AT5G47300.1 | Symbols: | F-box and associated interaction doma... 62.1 6e-09 > AT5G47300.1 | Symbols: | F-box and associated interaction domains-containing protein | chr5:19198125-19199375 FORWARD LENGTH=1251 Length=1251 Score = 62.1 bits (33), Expect = 6e-09 Identities = 33/33 (100%), Gaps = 0/33 (0%) Strand=Plus/Plus Query 305 AAGTCTTTCACTGTGACGGCTTATTGTTATGCA 337 ||||||||||||||||||||||||||||||||| Sbjct 419 AAGTCTTTCACTGTGACGGCTTATTGTTATGCA 451 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 27076205233 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5