BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg346083 Length=312 Score E Sequences producing significant alignments: (Bits) Value AT2G42730.1 | Symbols: | F-box family protein | chr2:17787454-... 75.0 4e-13 > AT2G42730.1 | Symbols: | F-box family protein | chr2:17787454-17791582 REVERSE LENGTH=2407 Length=2407 Score = 75.0 bits (40), Expect = 4e-13 Identities = 50/55 (91%), Gaps = 0/55 (0%) Strand=Plus/Plus Query 1 ATGCAGAAGCAGGAGTTCTTGGAGTTGTTCAAGGCTGCACAACGAGCGGCTAAGT 55 |||||||||||||||||||||||||||| | |||| |||| ||||||||||||| Sbjct 1664 ATGCAGAAGCAGGAGTTCTTGGAGTTGTACGAGGCAGCACTTCGAGCGGCTAAGT 1718 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14477111712 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5