BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg348672 Length=447 Score E Sequences producing significant alignments: (Bits) Value AT3G55860.1 | Symbols: | unknown protein; BEST Arabidopsis tha... 93.5 2e-18 > AT3G55860.1 | Symbols: | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60660.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr3:20727591-20729618 REVERSE LENGTH=1366 Length=1366 Score = 93.5 bits (50), Expect = 2e-18 Identities = 63/69 (91%), Gaps = 2/69 (3%) Strand=Plus/Plus Query 359 TGGCGGTGGTT-CTCTCCCCAAGCCCAACCGAGGAGATACTACAGAACAACCAACTTCAA 417 ||||||||||| | | |||||||||||||||||| |||| ||||||||||||||||||| Sbjct 1044 TGGCGGTGGTTGTTGT-CCCAAGCCCAACCGAGGAAATACAACAGAACAACCAACTTCAA 1102 Query 418 AATGAACCG 426 ||||||||| Sbjct 1103 AATGAACCG 1111 Score = 89.8 bits (48), Expect = 2e-17 Identities = 57/61 (93%), Gaps = 2/61 (3%) Strand=Plus/Plus Query 258 TTACACTAACATGGCAA-GGACGTTGCATCCAGAGTTGTTTTCAGATGATACAAATACAT 316 |||||| |||||||||| ||| |||||||||||||||||||||||||||| ||||||||| Sbjct 986 TTACACGAACATGGCAAGGGA-GTTGCATCCAGAGTTGTTTTCAGATGATTCAAATACAT 1044 Query 317 G 317 | Sbjct 1045 G 1045 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 21263257827 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5