BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg354904 Length=501 Score E Sequences producing significant alignments: (Bits) Value AT1G23201.1 | Symbols: | FUNCTIONS IN: molecular_function unkn... 89.8 2e-17 > AT1G23201.1 | Symbols: | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCK (InterPro:IPR012891); BEST Arabidopsis thaliana protein match is: GCK domain-containing protein (TAIR:AT5G02210.1); Has 106 Blast hits to 71 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:8230209-8230775 FORWARD LENGTH=567 Length=567 Score = 89.8 bits (48), Expect = 2e-17 Identities = 56/60 (93%), Gaps = 0/60 (0%) Strand=Plus/Plus Query 1 ATGTCATCCACGGATCTGAAACCGGAATCCAAATCTGAAAGTAACCAAGTCCCGTCCAAG 60 ||||||||||||||||||||||||||||||||| |||||| |||||||||| |||| ||| Sbjct 1 ATGTCATCCACGGATCTGAAACCGGAATCCAAACCTGAAAATAACCAAGTCTCGTCGAAG 60 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 23911453972 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5