BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg359097 Length=915 Score E Sequences producing significant alignments: (Bits) Value AT2G35190.1 | Symbols: NPSN11, ATNPSN11, NSPN11 | novel plant s... 119 5e-26 > AT2G35190.1 | Symbols: NPSN11, ATNPSN11, NSPN11 | novel plant snare 11 | chr2:14830626-14833319 FORWARD LENGTH=1599 Length=1599 Score = 119 bits (64), Expect = 5e-26 Identities = 76/82 (93%), Gaps = 0/82 (0%) Strand=Plus/Minus Query 1 ATGTGGATGTTCAAAATCGATAACGAAGAGACAGAAATCAAAATCTTGGGCACGAGCTCT 60 ||||||||||||||||||||||||||||||| ||| ||||||||| | ||||||||||| Sbjct 222 ATGTGGATGTTCAAAATCGATAACGAAGAGATAGATATCAAAATCACGAGCACGAGCTCT 163 Query 61 CTCTCCCCTACACACAGATTTT 82 ||||||||||||| |||||||| Sbjct 162 CTCTCCCCTACACCCAGATTTT 141 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 44708390830 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5