BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg359650 Length=627 Score E Sequences producing significant alignments: (Bits) Value AT1G09000.1 | Symbols: ANP1, MAPKKK1, NP1 | NPK1-related protei... 93.5 2e-18 > AT1G09000.1 | Symbols: ANP1, MAPKKK1, NP1 | NPK1-related protein kinase 1 | chr1:2891037-2895182 FORWARD LENGTH=2270 Length=2270 Score = 93.5 bits (50), Expect = 2e-18 Identities = 54/56 (96%), Gaps = 0/56 (0%) Strand=Plus/Plus Query 35 AGGAGCTTGAAGAAGAAGTTAAGCTTCTCAAAAATCTCTCCCATCCAAATATAGTT 90 |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct 424 AGGAGCTTGAAGAAGAAGTTAAGCTTCTTAAAAATCTCTCCCATCCTAATATAGTT 479 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 30240956494 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5