BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg489977 Length=168 Score E Sequences producing significant alignments: (Bits) Value AT4G11510.1 | Symbols: RALFL28 | ralf-like 28 | chr4:6984051-69... 217 3e-56 > AT4G11510.1 | Symbols: RALFL28 | ralf-like 28 | chr4:6984051-6984308 REVERSE LENGTH=258 Length=258 Score = 217 bits (117), Expect = 3e-56 Identities = 152/169 (90%), Gaps = 2/169 (1%) Strand=Plus/Plus Query 1 GCAAAAGACATTGGCTATCCAGGAATAGGACGAGGCGATCGCCAACCAGGATGTGATCAT 60 ||||| || ||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct 91 GCAAATGAGATTGGCTATCCAGGAATGGGACGCGGCGATCGCCAACCAGGATGTGATCAT 150 Query 61 GGCAATTGTCCACCCGACCAACCGGCGAATCCGTACCATCGGGGTTGTGAAATAGCAAAA 120 ||||| ||||||||||| ||||||||||||||||||||||| || ||||||| | |||| Sbjct 151 GGCAACTGTCCACCCGATCAACCGGCGAATCCGTACCATCGAGGATGTGAAAAATCAAAG 210 Query 121 AGATGTCGTGGTCCATCTCCACCAGTTCCTTC-TCAAAAGATGATATAA 168 ||||||||||||||| |||||||| || ||| || ||||||||||||| Sbjct 211 AGATGTCGTGGTCCAGATCCACCAGCTC-TTCCTCGAAAGATGATATAA 258 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 7293695895 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5