BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg887441 Length=249 Score E Sequences producing significant alignments: (Bits) Value AT3G17820.1 | Symbols: ATGSKB6, GLN1.3, GLN1;3 | glutamine synt... 117 5e-26 > AT3G17820.1 | Symbols: ATGSKB6, GLN1.3, GLN1;3 | glutamine synthetase 1.3 | chr3:6097414-6099595 FORWARD LENGTH=1341 Length=1341 Score = 117 bits (63), Expect = 5e-26 Identities = 93/107 (87%), Gaps = 3/107 (3%) Strand=Plus/Plus Query 4 ATGTGTGATCCTTATACACCAGCTGGTGTTCCAATTCCAACCAACAAGAGGCACAACGCT 63 ||||||||| |||| ||||||||||||| ||| ||||||||||||||||||||||||||| Sbjct 360 ATGTGTGATGCTTACACACCAGCTGGTGATCCTATTCCAACCAACAAGAGGCACAACGCT 419 Query 64 GCTAAAATTTTCAGACACCA--ATCGTTGCCTCCGAGGAGCCTTGGT 108 ||||| || ||||| |||| | ||||||| ||||||||||||| Sbjct 420 GCTAAGATCTTCAGCCACCCCGA-CGTTGCCAAGGAGGAGCCTTGGT 465 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11310243525 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5