BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg887811 Length=1083 Score E Sequences producing significant alignments: (Bits) Value AT3G20555.1 | Symbols: | unknown protein; BEST Arabidopsis tha... 156 5e-37 > AT3G20555.1 | Symbols: | unknown protein; BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF626) (TAIR:AT3G44770.2); Has 15 Blast hits to 15 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:7178200-7178614 REVERSE LENGTH=333 Length=333 Score = 156 bits (84), Expect = 5e-37 Identities = 92/96 (96%), Gaps = 0/96 (0%) Strand=Plus/Plus Query 907 ACCCGAGAAACTCATACTGACCCGTCTCTCAAGCTCGAGTCTATGAATGCTATCTTCCAC 966 ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| Sbjct 46 ACCCGAGAAACTCATACTGACCCGTCTCTAAAGCTCGAGTCTATGAATGCTGTCTTCCAC 105 Query 967 ATAAGCTTCAGGGCCAACAGTTGCGACTACACATCG 1002 |||||||||| |||||||||||||||||||| |||| Sbjct 106 ATAAGCTTCAAGGCCAACAGTTGCGACTACAAATCG 141 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 53061976065 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5