BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg887836 Length=1674 Score E Sequences producing significant alignments: (Bits) Value AT1G67520.1 | Symbols: | lectin protein kinase family protein ... 87.9 3e-16 > AT1G67520.1 | Symbols: | lectin protein kinase family protein | chr1:25302726-25305857 REVERSE LENGTH=2387 Length=2387 Score = 87.9 bits (47), Expect = 3e-16 Identities = 58/63 (92%), Gaps = 2/63 (3%) Strand=Plus/Plus Query 396 GGTTTTGTGGCAAAGTTTCGATTATCCAACAAACACT-TTACTTCCTGGGATGAAACTCG 454 ||||||||||||||||||||||||||||||| | ||| || ||||||||||||||||| | Sbjct 441 GGTTTTGTGGCAAAGTTTCGATTATCCAACAGATACTCTT-CTTCCTGGGATGAAACTAG 499 Query 455 GTT 457 ||| Sbjct 500 GTT 502 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 82730498160 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5