BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg887906 Length=204 Score E Sequences producing significant alignments: (Bits) Value AT3G28940.1 | Symbols: | AIG2-like (avirulence induced gene) f... 169 1e-41 AT3G28930.1 | Symbols: AIG2 | AIG2-like (avirulence induced gen... 104 3e-22 > AT3G28940.1 | Symbols: | AIG2-like (avirulence induced gene) family protein | chr3:10968100-10969387 REVERSE LENGTH=810 Length=810 Score = 169 bits (91), Expect = 1e-41 Identities = 107/115 (93%), Gaps = 0/115 (0%) Strand=Plus/Plus Query 78 TAGACTCAAAGGACGTTTGCATCCATGTATTTCTCCTTCTGAGAATGGAGTAATCAACGG 137 |||||||||||| || || ||| ||||||| |||||||||||||||||| |||||||||| Sbjct 211 TAGACTCAAAGGTCGCTTACATGCATGTATCTCTCCTTCTGAGAATGGACTAATCAACGG 270 Query 138 CAAGATACTAACTGGATTAACAGATGCTCAGTTAGAGAATTTAGATATGATTGAA 192 ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct 271 CAAGATACTAACTGGGTTAACAGATTCTCAGTTAGAGAATTTAGATATGATTGAA 325 > AT3G28930.1 | Symbols: AIG2 | AIG2-like (avirulence induced gene) family protein | chr3:10959686-10960808 REVERSE LENGTH=797 Length=797 Score = 104 bits (56), Expect = 3e-22 Identities = 64/68 (94%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 1 ATGACTAGCTCTGATCAATCTCCGTCGCACAACGTCTTCGTCTACGGCAGTTTCCAAGAA 60 ||||| ||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| Sbjct 81 ATGACAAGCTCCGATCAATCTCCATCGCACGACGTCTTCGTCTACGGCAGTTTCCAAGAA 140 Query 61 CCAGCCGT 68 |||||||| Sbjct 141 CCAGCCGT 148 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9104544531 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5