BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg888006 Length=180 Score E Sequences producing significant alignments: (Bits) Value AT5G51590.1 | Symbols: | AT hook motif DNA-binding family prot... 237 3e-62 > AT5G51590.1 | Symbols: | AT hook motif DNA-binding family protein | chr5:20956567-20959113 REVERSE LENGTH=1740 Length=1740 Score = 237 bits (128), Expect = 3e-62 Identities = 161/176 (91%), Gaps = 5/176 (3%) Strand=Plus/Minus Query 8 AACAACTCAAGATT-ATGACTGATCA-ATGTCGGATTCTTTCCATCGATCATCAGCTTGG 65 |||||||||||||| || || || | ||||||||||||||||||||||||||||||||| Sbjct 1494 AACAACTCAAGATTCATAACACAT-ATATGTCGGATTCTTTCCATCGATCATCAGCTTGG 1436 Query 66 AACCTCGGTGTCAGATTCGCTATGGCCTCCAAAttcttcatcatcttcaccttctaaatc 125 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1435 AACCTCGGTGTCAGATTCGCTATGGCCTCCGAATTCTTCATCATCTTCACCTTCTAAATC 1376 Query 126 ctcttcatcttcttcc-tcatcttcttctGGGAGGGGTGAGAAGAGATCCTTGATA 180 || |||||||||||| | ||||||| | ||||||| |||||||||||||||||| Sbjct 1375 ATCCTCATCTTCTTCCCT-ATCTTCTCCAGGGAGGGAAGAGAAGAGATCCTTGATA 1321 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 7897312107 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5