BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg891709 Length=276 Score E Sequences producing significant alignments: (Bits) Value AT5G25580.1 | Symbols: | BEST Arabidopsis thaliana protein mat... 137 4e-32 > AT5G25580.1 | Symbols: | BEST Arabidopsis thaliana protein match is: DDT domain superfamily (TAIR:AT1G18950.1); Has 178 Blast hits to 178 proteins in 75 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 33; Plants - 60; Viruses - 1; Other Eukaryotes - 29 (source: NCBI BLink). | chr5:8903505-8906311 FORWARD LENGTH=1466 Length=1466 Score = 137 bits (74), Expect = 4e-32 Identities = 85/90 (94%), Gaps = 2/90 (2%) Strand=Plus/Plus Query 58 GAGTTATCATCAAGCAAAGCTTCTTCTTTGGCTGCAATTGGTGG-GATGATTGAGACAGA 116 ||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||| Sbjct 799 GAGTTATCATCAAGCAAAGCTTCTTCTTTGGCTGCAACTGG-GCAGATGATTGAGACAGA 857 Query 117 AGCTATACCAGTTGTTGAGAAATATCATAA 146 ||||||||| |||||||||||||||||||| Sbjct 858 AGCTATACCCGTTGTTGAGAAATATCATAA 887 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12667472748 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5