BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg891972 Length=282 Score E Sequences producing significant alignments: (Bits) Value AT1G48920.1 | Symbols: ATNUC-L1, PARL1, NUC-L1 | nucleolin like... 104 4e-22 > AT1G48920.1 | Symbols: ATNUC-L1, PARL1, NUC-L1 | nucleolin like 1 | chr1:18098095-18101623 FORWARD LENGTH=1966 Length=1966 Score = 104 bits (56), Expect = 4e-22 Identities = 64/68 (94%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 164 CTGCTGCTACCAAGGCTGCAAGTAGTTCAGATTCATCTGATGAAGATTCTGATGAGGAAA 223 |||||||| ||||||||||||| || ||||||||||| |||||||||||||||||||||| Sbjct 711 CTGCTGCTGCCAAGGCTGCAAGCAGCTCAGATTCATCAGATGAAGATTCTGATGAGGAAA 770 Query 224 GTGAAGAT 231 |||||||| Sbjct 771 GTGAAGAT 778 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12969079242 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5