BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg894152 Length=255 Score E Sequences producing significant alignments: (Bits) Value AT1G49940.1 | Symbols: | BEST Arabidopsis thaliana protein mat... 113 7e-25 > AT1G49940.1 | Symbols: | BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G04770.1); Has 40 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | chr1:18488517-18491179 REVERSE LENGTH=994 Length=994 Score = 113 bits (61), Expect = 7e-25 Identities = 68/71 (96%), Gaps = 1/71 (1%) Strand=Plus/Plus Query 32 CAACAAATACTGCGAGATCTCATGGCAAGAAATTTCAGGTCACGGTCGAGAAGAAAACCA 91 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 631 CAACAAATACTGTGAGATCTCATGGCAAGAAATTTCAGGTCACGGTCGAGAAGAAA-CCA 689 Query 92 CTAGGATATTG 102 ||||||| ||| Sbjct 690 CTAGGATCTTG 700 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11611850019 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5