BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg894670 Length=402 Score E Sequences producing significant alignments: (Bits) Value AT5G27700.1 | Symbols: | Ribosomal protein S21e | chr5:980730... 65.8 3e-10 > AT5G27700.1 | Symbols: | Ribosomal protein S21e | chr5:9807302-9808506 REVERSE LENGTH=600 Length=600 Score = 65.8 bits (35), Expect = 3e-10 Identities = 40/42 (95%), Gaps = 1/42 (2%) Strand=Plus/Minus Query 37 GAGAGC-AGAGAGGAGAAGCGAAGCAGGTGCGGCAACGGGAG 77 |||||| |||||||||||||||||||||||||||||| |||| Sbjct 71 GAGAGCGAGAGAGGAGAAGCGAAGCAGGTGCGGCAACCGGAG 30 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 19001209122 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5