BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg895265 Length=183 Score E Sequences producing significant alignments: (Bits) Value AT2G11005.1 | Symbols: | glycine-rich protein | chr2:4348511-4... 71.3 3e-12 > AT2G11005.1 | Symbols: | glycine-rich protein | chr2:4348511-4349577 FORWARD LENGTH=513 Length=513 Score = 71.3 bits (38), Expect = 3e-12 Identities = 42/44 (95%), Gaps = 0/44 (0%) Strand=Plus/Plus Query 20 GTGGCTCCGGCGACGGCGGTGGCTCCGGCGACGGTGGTGGTTCC 63 |||||||||||||||||||||||||||||||||| ||||| ||| Sbjct 83 GTGGCTCCGGCGACGGCGGTGGCTCCGGCGACGGCGGTGGCTCC 126 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8048216160 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5