BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg896233 Length=330 Score E Sequences producing significant alignments: (Bits) Value AT1G65020.1 | Symbols: | FUNCTIONS IN: molecular_function unkn... 95.3 3e-19 > AT1G65020.1 | Symbols: | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NERD (InterPro:IPR011528); Has 69 Blast hits to 69 proteins in 27 species: Archae - 0; Bacteria - 18; Metazoa - 8; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | chr1:24154344-24156605 REVERSE LENGTH=1233 Length=1233 Score = 95.3 bits (51), Expect = 3e-19 Identities = 57/60 (95%), Gaps = 0/60 (0%) Strand=Plus/Plus Query 88 TGGCTGAGGTCAAGAAACAAGCTTCTGTTCTGGAATCATATCTTGAACAGAGGGGAGTTA 147 |||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||| Sbjct 435 TGGCGGAGGTCAAGAAACAAGCTTCAGTTCTTGAATCATATCTTGAACAGAGGGGAGTTA 494 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 15381931194 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5