BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg896827 Length=666 Score E Sequences producing significant alignments: (Bits) Value AT3G28945.1 | Symbols: | transposable element gene | chr3:1097... 108 8e-23 AT3G27883.1 | Symbols: | transposable element gene | chr3:1033... 102 4e-21 > AT3G28945.1 | Symbols: | transposable element gene | chr3:10970273-10975947 REVERSE LENGTH=5675 Length=5675 Score = 108 bits (58), Expect = 8e-23 Identities = 62/64 (97%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 196 GGAGGAAGCAAAAGAAAAGCTACTGATGAGGGTGAAGTTCCATCCAAAGTTGCAAAGTGC 255 |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 1447 GGAGGAGGCAAAAGAAAAGCTACTGATGAGGCTGAAGTTCCATCCAAAGTTGCAAAGTGC 1506 Query 256 AACA 259 |||| Sbjct 1507 AACA 1510 > AT3G27883.1 | Symbols: | transposable element gene | chr3:10339967-10345348 FORWARD LENGTH=5382 Length=5382 Score = 102 bits (55), Expect = 4e-21 Identities = 59/61 (97%), Gaps = 0/61 (0%) Strand=Plus/Plus Query 196 GGAGGAAGCAAAAGAAAAGCTACTGATGAGGGTGAAGTTCCATCCAAAGTTGCAAAGTGC 255 |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 1327 GGAGGAGGCAAAAGAAAAGCTACTGATGAGGCTGAAGTTCCATCCAAAGTTGCAAAGTGC 1386 Query 256 A 256 | Sbjct 1387 A 1387 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 32200088227 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5