BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg899881 Length=234 Score E Sequences producing significant alignments: (Bits) Value AT1G17370.1 | Symbols: UBP1B | oligouridylate binding protein 1... 82.4 2e-15 > AT1G17370.1 | Symbols: UBP1B | oligouridylate binding protein 1B | chr1:5951542-5955037 REVERSE LENGTH=1772 Length=1772 Score = 82.4 bits (44), Expect = 2e-15 Identities = 46/47 (98%), Gaps = 0/47 (0%) Strand=Plus/Plus Query 139 GTATGTTGGAAACATCCATATTCAGGTGACGGAACCTCTGCTTCAAG 185 ||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct 380 GTACGTTGGAAACATCCATATTCAGGTGACGGAACCTCTGCTTCAAG 426 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10556227290 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5