BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg900753 Length=408 Score E Sequences producing significant alignments: (Bits) Value AT3G25495.1 | Symbols: | pseudogene of leucine-rich repeat pro... 106 2e-22 AT4G29180.2 | Symbols: RHS16 | root hair specific 16 | chr4:143... 73.1 2e-12 > AT3G25495.1 | Symbols: | pseudogene of leucine-rich repeat protein | chr3:9244325-9250768 FORWARD LENGTH=6444 Length=6444 Score = 106 bits (57), Expect = 2e-22 Identities = 63/66 (95%), Gaps = 0/66 (0%) Strand=Plus/Plus Query 46 CTTAGTTCAAGTGGGTTACAAGGACCAATAGCCGTCTCATTTAGAAATCTCTCCTTTCTT 105 ||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||| Sbjct 3867 CTTAGTTCAAGTGGGTTACAAGGACCAATAGCCGTCTCATTTAGACATCTTTCCCTTCTT 3926 Query 106 GAGTCA 111 |||||| Sbjct 3927 GAGTCA 3932 > AT4G29180.2 | Symbols: RHS16 | root hair specific 16 | chr4:14385593-14389689 FORWARD LENGTH=2945 Length=2945 Score = 73.1 bits (39), Expect = 2e-12 Identities = 41/42 (98%), Gaps = 0/42 (0%) Strand=Plus/Plus Query 180 AGGACCACTTCTGCCTTCGGGAAAGAGAAGGTTCACATGTAG 221 |||||||||||||||||||||||||||||||||||||| ||| Sbjct 1676 AGGACCACTTCTGCCTTCGGGAAAGAGAAGGTTCACATATAG 1717 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 19302815616 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5