BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg901241 Length=264 Score E Sequences producing significant alignments: (Bits) Value AT2G34140.1 | Symbols: | Dof-type zinc finger DNA-binding fami... 111 2e-24 > AT2G34140.1 | Symbols: | Dof-type zinc finger DNA-binding family protein | chr2:14413758-14414765 REVERSE LENGTH=1008 Length=1008 Score = 111 bits (60), Expect = 2e-24 Identities = 67/70 (96%), Gaps = 2/70 (3%) Strand=Plus/Plus Query 1 TTTTCCTTTAAACCCGTTGAAGAACGTGGTGAATTTGGTTGCTATTGG-TACATACAGGC 59 ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 638 TTTTCCTCTAAACCCGTTGAAGAACGTGGTGAATTTGGTTGCTATTGGGTACATACAGGC 697 Query 60 TGGCAA-GTA 68 |||||| ||| Sbjct 698 TGGCAAAGTA 707 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12064259760 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5