BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg901740 Length=282 Score E Sequences producing significant alignments: (Bits) Value AT2G38580.1 | Symbols: | Mitochondrial ATP synthase D chain-re... 172 1e-42 > AT2G38580.1 | Symbols: | Mitochondrial ATP synthase D chain-related protein | chr2:16138570-16142588 FORWARD LENGTH=1774 Length=1774 Score = 172 bits (93), Expect = 1e-42 Identities = 103/108 (95%), Gaps = 0/108 (0%) Strand=Plus/Plus Query 22 TCCGCCGATGAAAATCATATCGGAGATGGTGACGTTCCTCCAATTACCGGAGGTCCAGAT 81 |||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| Sbjct 205 TCCGTCGATGAAAATCATATCGGAGATGGTGACGTTCCTCAAATTAGCGGAGGTCCAGAT 264 Query 82 GTCGATGAGTCGCAATCATCTCATCAGATCAATGTCGTCGCAACTGAA 129 | |||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 265 GCCGATGAGTCGCAATCATCTCATCAGATCGATGTCGTCGCAACTGAA 312 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12969079242 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5