BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg902344 Length=906 Score E Sequences producing significant alignments: (Bits) Value AT2G43375.1 | Symbols: | other RNA | chr2:18017116-18018691 RE... 169 5e-41 > AT2G43375.1 | Symbols: | other RNA | chr2:18017116-18018691 REVERSE LENGTH=1576 Length=1576 Score = 169 bits (91), Expect = 5e-41 Identities = 112/121 (93%), Gaps = 6/121 (5%) Strand=Plus/Minus Query 316 AAAAGAACAAAAAATGTAGCTGCTTTTAATTTGGAGGAAGACATGAGAAGACATCAGATC 375 ||||| || |||| |||||||||||||||||| ||||||||||||||||||||||||||| Sbjct 481 AAAAG-AC-AAAACTGTAGCTGCTTTTAATTTAGAGGAAGACATGAGAAGACATCAGATC 424 Query 376 AAGACTGCCTCCAATCGTGATAAGAAGCTAAAAAATA-T--AGGCACCATGCAAAAG-TT 431 ||||||||||||||||||||||||||||||| ||||| | |||||||||||||||| || Sbjct 423 AAGACTGCCTCCAATCGTGATAAGAAGCTAATAAATAATGTAGGCACCATGCAAAAGGTT 364 Query 432 G 432 | Sbjct 363 G 363 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 44256283507 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5