BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg905352 Length=312 Score E Sequences producing significant alignments: (Bits) Value AT4G02580.1 | Symbols: | NADH-ubiquinone oxidoreductase 24 kDa... 174 4e-43 > AT4G02580.1 | Symbols: | NADH-ubiquinone oxidoreductase 24 kDa subunit, putative | chr4:1134467-1137156 FORWARD LENGTH=1137 Length=1137 Score = 174 bits (94), Expect = 4e-43 Identities = 108/115 (94%), Gaps = 0/115 (0%) Strand=Plus/Plus Query 1 GTTAAGGAGATACTCTCTTACTATCCATCCAATTACAAGCAGTTTGCAGTTATTCCTCTT 60 ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 288 GTTAAGGAGATTCTCTCTTACTATCCATCCAATTACAAGCAGTCCGCAGTTATTCCTCTC 347 Query 61 CTAGATCTTGCACAACAGCAGCATGGAGGCTGGCTCCCTGTTTCTGCTATGAATG 115 ||||||||||||||||||||| |||||||||||||||||||||| || ||||||| Sbjct 348 CTAGATCTTGCACAACAGCAGAATGGAGGCTGGCTCCCTGTTTCAGCAATGAATG 402 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14477111712 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5