BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg905455 Length=207 Score E Sequences producing significant alignments: (Bits) Value AT3G06540.1 | Symbols: REP, AthREP | Rab escort protein | chr3:... 100 4e-21 > AT3G06540.1 | Symbols: REP, AthREP | Rab escort protein | chr3:2035003-2037788 REVERSE LENGTH=2016 Length=2016 Score = 100 bits (54), Expect = 4e-21 Identities = 57/58 (98%), Gaps = 1/58 (2%) Strand=Plus/Plus Query 41 CAA-GAGAACTTCCACAAGCCTTTTGTCGTCGGGCTGCTGTCAAAGGATGTATCTATG 97 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1009 CAAGGAGAACTTCCACAAGCCTTTTGTCGTCGGGCTGCTGTCAAAGGATGTATCTATG 1066 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9255448584 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5