BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg906129 Length=177 Score E Sequences producing significant alignments: (Bits) Value AT5G25380.1 | Symbols: CYCA2;1 | cyclin a2;1 | chr5:8815230-881... 76.8 6e-14 > AT5G25380.1 | Symbols: CYCA2;1 | cyclin a2;1 | chr5:8815230-8817566 FORWARD LENGTH=1314 Length=1314 Score = 76.8 bits (41), Expect = 6e-14 Identities = 55/62 (89%), Gaps = 0/62 (0%) Strand=Plus/Plus Query 87 GTTCCCACCACCAAAACGTTTCTCAGGCGATTCATTCAAGCAGCACAAGCGTCTCACAAG 146 ||||||||||||||||||||||||||||| ||||||| || || ||||||||| | ||| Sbjct 910 GTTCCCACCACCAAAACGTTTCTCAGGCGGTTCATTCGCGCCGCTCAAGCGTCTGATAAG 969 Query 147 GT 148 || Sbjct 970 GT 971 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 7746408054 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5