BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg906143 Length=252 Score E Sequences producing significant alignments: (Bits) Value AT2G14160.1 | Symbols: | RNA-binding (RRM/RBD/RNP motifs) fami... 84.2 5e-16 > AT2G14160.1 | Symbols: | RNA-binding (RRM/RBD/RNP motifs) family protein | chr2:5976465-5976801 REVERSE LENGTH=258 Length=258 Score = 84.2 bits (45), Expect = 5e-16 Identities = 52/55 (95%), Gaps = 1/55 (2%) Strand=Plus/Plus Query 156 ATATGGATTTGTTAGTTTCAAAGATGAGAAATCCATGAAGGACGCCATTAATGGG 210 ||||||||||||||||||||||||||||||||| |||||||| |||||||| ||| Sbjct 201 ATATGGATTTGTTAGTTTCAAAGATGAGAAATCAATGAAGGATGCCATTAA-GGG 254 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11461046772 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5