BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg906307 Length=720 Score E Sequences producing significant alignments: (Bits) Value AT5G46915.1 | Symbols: | transcriptional factor B3 family prot... 115 5e-25 > AT5G46915.1 | Symbols: | transcriptional factor B3 family protein | chr5:19051568-19053200 REVERSE LENGTH=867 Length=867 Score = 115 bits (62), Expect = 5e-25 Identities = 98/114 (86%), Gaps = 8/114 (7%) Strand=Plus/Plus Query 274 GATGGGAAGGAGATGATGCAACCTCCACAATCC-AGTTCCTTCTTGGCTTCTTCAAGCCG 332 |||||||||||||||||||||||||||||| || || |||||||||| |||||||| || Sbjct 283 GATGGGAAGGAGATGATGCAACCTCCACAA-CCTAGAGCCTTCTTGGCATCTTCAAGTCG 341 Query 333 TGGTA-----T-CAAAACAGAACAAAGGGAAGATGACAAGAAGGAAGAGGTGGT 380 | || | || |||||||||| |||||||||||||||||||||||||||| Sbjct 342 TATTAGAAGATTCAGAACAGAACAAGGGGAAGATGACAAGAAGGAAGAGGTGGT 395 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 34912732165 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5