BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg909428 Length=195 Score E Sequences producing significant alignments: (Bits) Value AT1G78040.1 | Symbols: | Pollen Ole e 1 allergen and extensin ... 289 8e-78 > AT1G78040.1 | Symbols: | Pollen Ole e 1 allergen and extensin family protein | chr1:29345838-29347107 FORWARD LENGTH=938 Length=938 Score = 289 bits (156), Expect = 8e-78 Identities = 179/190 (94%), Gaps = 2/190 (1%) Strand=Plus/Plus Query 7 TGCTCTAAAATCTCCGTTGGACGCGAGAAGTCTCGCGTGATCTTGAACCATTACAGTGGC 66 ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| Sbjct 483 TGCTCTAAAATCTCCGTTGGACGTGAGAAGTCTCGTGTGATCTTGAACCATTACAGTGGC 542 Query 67 ATTGCCTCGCAGATCA-AGCACGCTAACAACATGGGATTCGAGAAAGAAGTGAGCGATGT 125 |||||||||||||||| | || ||||||||||||||||| |||||||||||||| ||||| Sbjct 543 ATTGCCTCGCAGATCAGA-CATGCTAACAACATGGGATTTGAGAAAGAAGTGAGTGATGT 601 Query 126 GTTCTGCTCTGCTCTGTTTCACAAGTATATGGTTGATGAAGATGAGGATGATATTCAAAG 185 ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||| Sbjct 602 GTTCTGCTCTGCTTTGTTTCAGAAGTATATGGTTGATGAAGATGAGGATGATATTAAAAA 661 Query 186 CCATCTCTAA 195 |||||||||| Sbjct 662 CCATCTCTAA 671 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8651832372 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5