BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg912291 Length=225 Score E Sequences producing significant alignments: (Bits) Value AT1G27250.1 | Symbols: | Paired amphipathic helix (PAH2) super... 134 4e-31 > AT1G27250.1 | Symbols: | Paired amphipathic helix (PAH2) superfamily protein | chr1:9468568-9469634 FORWARD LENGTH=414 Length=414 Score = 134 bits (72), Expect = 4e-31 Identities = 80/84 (95%), Gaps = 0/84 (0%) Strand=Plus/Plus Query 1 ATGGTGGGAGGAGGAAGTAAACATGTTGGAGAAGGAAGTAAACCGAAGGCAAATATAGAT 60 |||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||| Sbjct 1 ATGGTGGGAGGAGGAAGTAAACATGTTGGAGAAGGAAGTAAACCGAGGGCAACTAAAGAT 60 Query 61 GATGCGTATGCATATCTTAGGGCT 84 || ||||||||||||||||||||| Sbjct 61 GACGCGTATGCATATCTTAGGGCT 84 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10103817549 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5